| RB454 |
Tested for in situ hybridization. |
| Accession no. | pB-01564 |
| Specificity | Pirellula sp. strain SH1
|
| Check specificity |
|
| Target molecule | 16S rRNA |
| Position* | 454 - 473 |
| Sequence* | 5'- ATG ATG GAT AAC CAC CAT GC -3' |
| Length [nt] | 20 |
| G+C content [%] | 45 |
| Tm [°C]* | 50 |
| MW [g/mol] | 6107 |
| Formamide [%]* | 30 |
| Reference | Gade D, Schlesner H, Glöckner FO, Amann R, Pfeiffer S, Thomm M. (2003). Identification of planctomycetes with order-, genus-, and strain-specific 16S rRNA-targeted probes. Microb Ecol. 47(3):243-51
Abstract (PUBMED)
|
| Remarks | helper probes for RB454: RB433H ATTTCCTAACAACTGACAGCG; RB474H CCTCTGAAGATCGGTCAAAC
|
| User comments
|
|
Print view
|
| Glossary |
Name (Alm et al., 1996). Probe designation according to Alm, E. W., Oerther, D. B., Larsen, N., Stahl, D. A., Raskin, L. (1996). The oligonucleotide probe database. Appl Environ Microbiol 62: 3557-9.
Abstract (PUBMED).
Difference alignment. Difference alignment based on ARB probe match results (ARB database release June 2001). Abbreviations: mis = number of mismatches, wmis = weighted mismatch, ecoli = position according to E. coli gene numbering.
Position. Probe position according to the E. coli gene numbering.
Sequence. Sequence in IUPAC code: R=G/A, Y=T/C, M=A/C, K=G/T, S=G/C, W=A/T, H=A/C/T, B=G/T/C, V=G/C/A, D=G/A/T, N=G/A/T/C
Tm. Dissoziation temperature according to: Tm=64.9 + 41 x ((G + C - 16.4)/length).
delta Gs. deltaG's: ΔG1 and ΔG2 are standard free energy changes for probe/rRNA duplex formation and probe folding, respectively. ΔG12 is a combined free energy parameter obtained from equilibrium chemistry using ΔG1 and ΔG2 (i.e., it is the thermodynamic affinity of the probe to a hypothetical perfectly accessible target site). All values calculated according to Yilmaz and Noguera (2006). Making all Parts of the 16S rRNA of Escherichia coli accessible in situ to single DNA oligonucleotides. Appl Environ Microbiol 72: 733-744.
Abstract (PUBMED).
Formamide. Percent formamide in the hybridization buffer for optimal hybridization conditions in FISH experiments.
|
|
If you use probeBase as a tool in your published research, we ask that this paper be cited:
Loy A, Maixner F, Wagner M, Horn M. 2007. probeBase - an online resource for rRNA-targeted oligonucleotide probes: new features 2007. Nucleic Acids Res. 35: D800-D804. PDF
Suggested wording: (i) "Oligonucleotide probe sequences have been deposited at probeBase.", or (ii) "Details on oligonucleotide probes are available at probeBase."
|
|